ID: 1091045317_1091045329

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1091045317 1091045329
Species Human (GRCh38) Human (GRCh38)
Location 11:132319838-132319860 11:132319877-132319899
Sequence CCCCGAGTAGCCTAACGGGAGGC AGACTGACACCTCACACAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 892} {0: 240, 1: 1110, 2: 2392, 3: 1067, 4: 718}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!