ID: 1091057133_1091057145

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091057133 1091057145
Species Human (GRCh38) Human (GRCh38)
Location 11:132429885-132429907 11:132429930-132429952
Sequence CCATAGGCTGACCCCCGGGAAGA AGCTAGAAGCAGACTGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86} {0: 1, 1: 0, 2: 4, 3: 39, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!