ID: 1091085782_1091085792

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1091085782 1091085792
Species Human (GRCh38) Human (GRCh38)
Location 11:132720286-132720308 11:132720332-132720354
Sequence CCGGCCAAGACCTGGCCACAGCC TACCTCCTGAGCAGCTCTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 368} {0: 1, 1: 0, 2: 2, 3: 6, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!