ID: 1091086590_1091086594

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1091086590 1091086594
Species Human (GRCh38) Human (GRCh38)
Location 11:132727312-132727334 11:132727341-132727363
Sequence CCTGTGCCTAGAGATTTAGGTGA GTTCCCATCCTCATTTCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 174} {0: 1, 1: 0, 2: 1, 3: 19, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!