ID: 1091089385_1091089388

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091089385 1091089388
Species Human (GRCh38) Human (GRCh38)
Location 11:132755914-132755936 11:132755959-132755981
Sequence CCACACAGCAAGTGGCTGACAGC TCCAGCTGCTAGGAAAATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 188} {0: 1, 1: 0, 2: 2, 3: 20, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!