ID: 1091098357_1091098363

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1091098357 1091098363
Species Human (GRCh38) Human (GRCh38)
Location 11:132845517-132845539 11:132845554-132845576
Sequence CCAGTAGCTATGGGGAGGGATTA CAGATGTTCTCTGGGATCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87} {0: 1, 1: 0, 2: 0, 3: 20, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!