ID: 1091105383_1091105385

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1091105383 1091105385
Species Human (GRCh38) Human (GRCh38)
Location 11:132914366-132914388 11:132914404-132914426
Sequence CCTGGTAATATGGTTCGTCTCTT CTGTTCCAATATAATATTTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 145} {0: 2, 1: 0, 2: 3, 3: 32, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!