ID: 1091108407_1091108416

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1091108407 1091108416
Species Human (GRCh38) Human (GRCh38)
Location 11:132943715-132943737 11:132943743-132943765
Sequence CCTCTGCAGCCCGGTCGGCGACT CCAGCCGGGGGAGCGCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50} {0: 1, 1: 0, 2: 1, 3: 19, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!