ID: 1091109631_1091109634

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1091109631 1091109634
Species Human (GRCh38) Human (GRCh38)
Location 11:132953744-132953766 11:132953760-132953782
Sequence CCAGGCTCTAAATCTGGACCTGC GACCTGCCCCCTGAGAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153} {0: 1, 1: 0, 2: 1, 3: 25, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!