ID: 1091111599_1091111604

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1091111599 1091111604
Species Human (GRCh38) Human (GRCh38)
Location 11:132974023-132974045 11:132974055-132974077
Sequence CCTCCAGCTGCTATGGAGAAGCT CGCATAATCACTCATGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 145} {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!