ID: 1091119359_1091119362

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1091119359 1091119362
Species Human (GRCh38) Human (GRCh38)
Location 11:133043876-133043898 11:133043919-133043941
Sequence CCTTTATTCATTTGTGCATACAT TTGGTGATCTTCCAGGTACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 469} {0: 1, 1: 0, 2: 1, 3: 8, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!