ID: 1091127073_1091127077

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091127073 1091127077
Species Human (GRCh38) Human (GRCh38)
Location 11:133109973-133109995 11:133110008-133110030
Sequence CCATAGGACATTTGACAATCTCT GTTCGACAGGACTTGGGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 191, 4: 800} {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!