ID: 1091138058_1091138061

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1091138058 1091138061
Species Human (GRCh38) Human (GRCh38)
Location 11:133210611-133210633 11:133210624-133210646
Sequence CCCTGTTCCATCAAAGTTGAAAT AAGTTGAAATGACCACAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 226} {0: 1, 1: 0, 2: 3, 3: 28, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!