ID: 1091154599_1091154615

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1091154599 1091154615
Species Human (GRCh38) Human (GRCh38)
Location 11:133361525-133361547 11:133361573-133361595
Sequence CCCGTGTCCCGGCGCGCAGACAG GGGCACCTGCAGCTATTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75} {0: 2, 1: 3, 2: 1, 3: 17, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!