ID: 1091161268_1091161271

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1091161268 1091161271
Species Human (GRCh38) Human (GRCh38)
Location 11:133423209-133423231 11:133423256-133423278
Sequence CCTTGATCATTTTAATTGCCTCA TTGTCTTCAGTTTTAGCAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 408} {0: 1, 1: 0, 2: 0, 3: 28, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!