ID: 1091168814_1091168819

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1091168814 1091168819
Species Human (GRCh38) Human (GRCh38)
Location 11:133502746-133502768 11:133502796-133502818
Sequence CCCACTATTCTGCTTCTCAGGAG TGTGGCCAGAATTCCTGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 236} {0: 1, 1: 0, 2: 0, 3: 26, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!