ID: 1091213618_1091213621

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1091213618 1091213621
Species Human (GRCh38) Human (GRCh38)
Location 11:133885563-133885585 11:133885592-133885614
Sequence CCCTCTGTGGGCTACAACCACTG CAGTCCTAATGAGATGAACCAGG
Strand - +
Off-target summary {0: 1, 1: 18, 2: 424, 3: 731, 4: 1104} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!