ID: 1091216708_1091216716

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1091216708 1091216716
Species Human (GRCh38) Human (GRCh38)
Location 11:133906767-133906789 11:133906795-133906817
Sequence CCACATCCCAGTGCATCCCAGGG CTGAGCCCCGTGAGCTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 313} {0: 1, 1: 0, 2: 1, 3: 23, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!