ID: 1091216708_1091216717

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1091216708 1091216717
Species Human (GRCh38) Human (GRCh38)
Location 11:133906767-133906789 11:133906796-133906818
Sequence CCACATCCCAGTGCATCCCAGGG TGAGCCCCGTGAGCTCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 313} {0: 1, 1: 0, 2: 0, 3: 15, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!