ID: 1091217877_1091217887

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1091217877 1091217887
Species Human (GRCh38) Human (GRCh38)
Location 11:133914597-133914619 11:133914650-133914672
Sequence CCCTTCCGGGACACCTGCTGTCC CATAGCCACAGGACAAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 166} {0: 1, 1: 0, 2: 0, 3: 18, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!