ID: 1091217878_1091217881

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1091217878 1091217881
Species Human (GRCh38) Human (GRCh38)
Location 11:133914598-133914620 11:133914613-133914635
Sequence CCTTCCGGGACACCTGCTGTCCA GCTGTCCACCTGTTTAGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 161} {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!