ID: 1091217879_1091217887

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1091217879 1091217887
Species Human (GRCh38) Human (GRCh38)
Location 11:133914602-133914624 11:133914650-133914672
Sequence CCGGGACACCTGCTGTCCACCTG CATAGCCACAGGACAAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 372} {0: 1, 1: 0, 2: 0, 3: 18, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!