ID: 1091220511_1091220527

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1091220511 1091220527
Species Human (GRCh38) Human (GRCh38)
Location 11:133927604-133927626 11:133927648-133927670
Sequence CCATAATGACCAGGGGTTTCCCC AGGCCGTAAGGGTTGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 99} {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!