ID: 1091220519_1091220531

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1091220519 1091220531
Species Human (GRCh38) Human (GRCh38)
Location 11:133927625-133927647 11:133927678-133927700
Sequence CCACAGTGGGGCCAGGATCCCTA ATGCATGGAGAGTAGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 224} {0: 1, 1: 0, 2: 3, 3: 48, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!