ID: 1091220521_1091220531

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1091220521 1091220531
Species Human (GRCh38) Human (GRCh38)
Location 11:133927636-133927658 11:133927678-133927700
Sequence CCAGGATCCCTAAGGCCGTAAGG ATGCATGGAGAGTAGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 42} {0: 1, 1: 0, 2: 3, 3: 48, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!