ID: 1091220741_1091220758

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1091220741 1091220758
Species Human (GRCh38) Human (GRCh38)
Location 11:133928623-133928645 11:133928673-133928695
Sequence CCAGCTCAAGGTTGTCACCCCCG CTCAAACAGGAGTGTAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 52} {0: 1, 1: 0, 2: 2, 3: 10, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!