ID: 1091223267_1091223270

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1091223267 1091223270
Species Human (GRCh38) Human (GRCh38)
Location 11:133943415-133943437 11:133943437-133943459
Sequence CCAGGGACACAAAGAGGAGACTC CTCCCTCCAGGGAGACCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 422} {0: 1, 1: 0, 2: 2, 3: 30, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!