ID: 1091229549_1091229553

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1091229549 1091229553
Species Human (GRCh38) Human (GRCh38)
Location 11:133979095-133979117 11:133979118-133979140
Sequence CCAGCATCAACTGCCAGCCACAT GAGTGAACCTCCTTGGAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 15, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!