ID: 1091235700_1091235716

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091235700 1091235716
Species Human (GRCh38) Human (GRCh38)
Location 11:134020780-134020802 11:134020815-134020837
Sequence CCTGAGCCTCCCTGTGCTCTCCT TAGGAGGGCGCCTCCGATGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 53, 4: 631} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!