ID: 1091243200_1091243204

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1091243200 1091243204
Species Human (GRCh38) Human (GRCh38)
Location 11:134069008-134069030 11:134069042-134069064
Sequence CCTGGCAGGCTGGGCGCATGCGC AAGCCGCGCCGCGCTGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 212} {0: 1, 1: 0, 2: 2, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!