ID: 1091249112_1091249114

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1091249112 1091249114
Species Human (GRCh38) Human (GRCh38)
Location 11:134127070-134127092 11:134127103-134127125
Sequence CCAAAGCGTGTAGTTAATCTCTT ATAGGAAGAAGAAGAATTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 193} {0: 1, 1: 0, 2: 8, 3: 56, 4: 700}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!