ID: 1091254125_1091254134

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1091254125 1091254134
Species Human (GRCh38) Human (GRCh38)
Location 11:134168746-134168768 11:134168797-134168819
Sequence CCTTAGGAAGCGATTCTCACGAC CACAGTAAAGACCTGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22} {0: 1, 1: 1, 2: 2, 3: 26, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!