ID: 1091255048_1091255051

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1091255048 1091255051
Species Human (GRCh38) Human (GRCh38)
Location 11:134176365-134176387 11:134176383-134176405
Sequence CCTTCCATTTCACAAATTCCTCC CCTCCTGTGCAGAGAGAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 322} {0: 1, 1: 1, 2: 2, 3: 45, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!