ID: 1091263675_1091263693

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1091263675 1091263693
Species Human (GRCh38) Human (GRCh38)
Location 11:134253820-134253842 11:134253858-134253880
Sequence CCTTCCGGCCAGTCACCCCCCCG CCGGCCGGTCACCCCCGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 240} {0: 1, 1: 2, 2: 3, 3: 9, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!