ID: 1091263686_1091263693

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1091263686 1091263693
Species Human (GRCh38) Human (GRCh38)
Location 11:134253840-134253862 11:134253858-134253880
Sequence CCGGCCTGGCTCCCTACTCCGGC CCGGCCGGTCACCCCCGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 314} {0: 1, 1: 2, 2: 3, 3: 9, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!