ID: 1091282906_1091282915

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091282906 1091282915
Species Human (GRCh38) Human (GRCh38)
Location 11:134391968-134391990 11:134392013-134392035
Sequence CCGGCAGGTGCTCCACGGGGACC TTGACCTCGTCTTTACAATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185} {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!