ID: 1091286864_1091286879

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1091286864 1091286879
Species Human (GRCh38) Human (GRCh38)
Location 11:134412573-134412595 11:134412622-134412644
Sequence CCACCCCGCCTCCATCCTGGCTG TCTCAAAGGGTGATTGTTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 122, 4: 1610} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!