ID: 1091286875_1091286885

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091286875 1091286885
Species Human (GRCh38) Human (GRCh38)
Location 11:134412606-134412628 11:134412641-134412663
Sequence CCAGCTTGGCAGCCTCTCTCAAA CCGGCCGGGCTGCTGCAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 32, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!