ID: 1091286878_1091286892

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1091286878 1091286892
Species Human (GRCh38) Human (GRCh38)
Location 11:134412618-134412640 11:134412651-134412673
Sequence CCTCTCTCAAAGGGTGATTGTTT TGCTGCAGGAGGGCGGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!