ID: 1091286945_1091286967

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1091286945 1091286967
Species Human (GRCh38) Human (GRCh38)
Location 11:134412839-134412861 11:134412887-134412909
Sequence CCTCACCCCAGCCTCCCCTTCCG AGAGGCCCGGGAGGCCTGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 115, 4: 1285} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!