ID: 1091286961_1091286976

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1091286961 1091286976
Species Human (GRCh38) Human (GRCh38)
Location 11:134412872-134412894 11:134412902-134412924
Sequence CCCGGCGTTCCGGAGAGAGGCCC CTGCGTGGGCGGACGGGCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!