ID: 1091308557_1091308559

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1091308557 1091308559
Species Human (GRCh38) Human (GRCh38)
Location 11:134556811-134556833 11:134556848-134556870
Sequence CCTACTGTCAAACAAGGCAGGTA TGGCCAGTTTGTACACACATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 58, 4: 243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!