ID: 1091321164_1091321173

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1091321164 1091321173
Species Human (GRCh38) Human (GRCh38)
Location 11:134652975-134652997 11:134653013-134653035
Sequence CCTTCCCACAACCCTTGAGAGTG GCTTCATCACGGCACTGCAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!