ID: 1091324698_1091324705

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1091324698 1091324705
Species Human (GRCh38) Human (GRCh38)
Location 11:134677484-134677506 11:134677513-134677535
Sequence CCAACCTCCTGTTCCCTCCTCTC TCAGAGCCCTCTCTCTAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 165, 4: 1315} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!