ID: 1091373273_1091373277

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1091373273 1091373277
Species Human (GRCh38) Human (GRCh38)
Location 12:10690-10712 12:10723-10745
Sequence CCCTCGCGGTGCTCTCCGGGTCT GAACGCAACTCCGCCGGCGCAGG
Strand - +
Off-target summary {0: 4, 1: 7, 2: 37, 3: 24, 4: 75} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!