ID: 1091377401_1091377417

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1091377401 1091377417
Species Human (GRCh38) Human (GRCh38)
Location 12:34123-34145 12:34171-34193
Sequence CCCTGCCTGCCTTTGCTGGCCAG AAGGCTGCAGGGTTGGTCCCAGG
Strand - +
Off-target summary No data {0: 7, 1: 1, 2: 5, 3: 25, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!