ID: 1091383664_1091383672

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1091383664 1091383672
Species Human (GRCh38) Human (GRCh38)
Location 12:78345-78367 12:78383-78405
Sequence CCGGGGCTAGTGTGATGGTGCGA GAAGAAGGGGACATTGAGGCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 83} {0: 2, 1: 1, 2: 6, 3: 48, 4: 587}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!