ID: 1091397645_1091397655

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091397645 1091397655
Species Human (GRCh38) Human (GRCh38)
Location 12:163478-163500 12:163513-163535
Sequence CCCTGCCCGCGTGCAGGTGCTGT GCCGCCTGGTGTGCTGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113} {0: 1, 1: 1, 2: 0, 3: 23, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!