ID: 1091402055_1091402056

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1091402055 1091402056
Species Human (GRCh38) Human (GRCh38)
Location 12:187100-187122 12:187123-187145
Sequence CCTCAGGGCTTCTGCTGCAAAAA TCAATTTTTTCATGCCACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 252} {0: 1, 1: 0, 2: 0, 3: 14, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!