ID: 1091402055_1091402059

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1091402055 1091402059
Species Human (GRCh38) Human (GRCh38)
Location 12:187100-187122 12:187147-187169
Sequence CCTCAGGGCTTCTGCTGCAAAAA CAAATTGTAGCTGCCAGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 252} {0: 1, 1: 0, 2: 2, 3: 6, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!